Recombinant:Article Title: NMDA receptors regulate the firing rate set point of hippocampal circuits without altering single-cell dynamics.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Cdc42-Forward 5’ TTGTTGGTGATGGTGCTGTTGG N/A Cdc42-Reverse 5’GCTCTCCACCAATCATAACTGTGAC N/A Grin1-Forward 5’ GATGCCCGTAGGAAGCAGATG N/A Grin1-Reverse 5’ GGCTCTGCTCTACCACTCTTTCT N/A Recombinant DNA Plasmid: pcDNA3-HA-eEF2K Kruiswijit et al.96 Addgene plasmid #110160 Plasmid: pAAV-FLEX-tdTomato Boyden lab. Addgene plasmid #28306 Plasmid: pAAV-hDlx-GqDREADD-dTomato-Fishell-4 Dimidschstein et al.97 Addgene plasmid #83897 Software and algorithms Plexon offline-sorter V3 Plexon inc. USA RRID: SCR_000012 Matlab MathWorks RRID: SCR_001622 MiniAnalysis Synaptosoft, Decatur, Georgia, USA RRID: SCR_002184 Graphpad Prism 10.2.2 Graphpad RRID: SCR_002798 ImageJ- Fiji RRID: SCR_002285 AccuSleep – sleep scoring software Barger et al.98 GitHub - zekebarger/AccuSleep: Automatically score rodent sleep using EEG and EMG recordings KlustaKwik – spike sorting software Kadirs et al.99 https://klustakwik.sourceforge.net/ Cell Explorer – cell type characterization Petersen et al.100 https://cellexplorer.org/ Chronux – spectral analysis Bokil et al.101 http://chronux.org/ Custom MATLAB code This paper https://doi.org/10.5281/zenodo.13773883 Other 120MEA200/30iR-Ti Multi Channel Systems MCS-890095 MEA2100-System Multi Channel Systems RRID:SCR_014809 MEA2100-mini-system Multi Channel Systems N/A Micro syringe pump World Precision Instruments UMP3 Pump controller World Precision Instruments MICRO2T Microliter syringe Hamilton Cat# 701RN Syringe needle Hamilton Cat# 7803-03 Cannula tube 23 AWG Component supply Cat# HTX-23T-30 Cannula tube 33 AWG Component supply Cat# HTX-23R Filler rode Component supply Cat# HTX-28R-30 Isoflurane anesthesia vaporizer Kent Scientific SomnoSuite Osmotic pump Alzet Cat# 1007D Vinyl catheter tubing Durect Cat# 007760 Acquisition board for in vivo recordings Open Ephys Cat# OEPS-9030 Amplifier chip (Single units) Intan Cat# RHD2132 Amplifier chip (EEG and EMG) Intan #RHD2216 Custom head fixation apparatus Heim et al.102 https://github.com/leoreh/slutsky_fepsp
Plasmid Preparation:Article Title: NMDA receptors regulate the firing rate set point of hippocampal circuits without altering single-cell dynamics.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Cdc42-Forward 5’ TTGTTGGTGATGGTGCTGTTGG N/A Cdc42-Reverse 5’GCTCTCCACCAATCATAACTGTGAC N/A Grin1-Forward 5’ GATGCCCGTAGGAAGCAGATG N/A Grin1-Reverse 5’ GGCTCTGCTCTACCACTCTTTCT N/A Recombinant DNA Plasmid: pcDNA3-HA-eEF2K Kruiswijit et al.96 Addgene plasmid #110160 Plasmid: pAAV-FLEX-tdTomato Boyden lab. Addgene plasmid #28306 Plasmid: pAAV-hDlx-GqDREADD-dTomato-Fishell-4 Dimidschstein et al.97 Addgene plasmid #83897 Software and algorithms Plexon offline-sorter V3 Plexon inc. USA RRID: SCR_000012 Matlab MathWorks RRID: SCR_001622 MiniAnalysis Synaptosoft, Decatur, Georgia, USA RRID: SCR_002184 Graphpad Prism 10.2.2 Graphpad RRID: SCR_002798 ImageJ- Fiji RRID: SCR_002285 AccuSleep – sleep scoring software Barger et al.98 GitHub - zekebarger/AccuSleep: Automatically score rodent sleep using EEG and EMG recordings KlustaKwik – spike sorting software Kadirs et al.99 https://klustakwik.sourceforge.net/ Cell Explorer – cell type characterization Petersen et al.100 https://cellexplorer.org/ Chronux – spectral analysis Bokil et al.101 http://chronux.org/ Custom MATLAB code This paper https://doi.org/10.5281/zenodo.13773883 Other 120MEA200/30iR-Ti Multi Channel Systems MCS-890095 MEA2100-System Multi Channel Systems RRID:SCR_014809 MEA2100-mini-system Multi Channel Systems N/A Micro syringe pump World Precision Instruments UMP3 Pump controller World Precision Instruments MICRO2T Microliter syringe Hamilton Cat# 701RN Syringe needle Hamilton Cat# 7803-03 Cannula tube 23 AWG Component supply Cat# HTX-23T-30 Cannula tube 33 AWG Component supply Cat# HTX-23R Filler rode Component supply Cat# HTX-28R-30 Isoflurane anesthesia vaporizer Kent Scientific SomnoSuite Osmotic pump Alzet Cat# 1007D Vinyl catheter tubing Durect Cat# 007760 Acquisition board for in vivo recordings Open Ephys Cat# OEPS-9030 Amplifier chip (Single units) Intan Cat# RHD2132 Amplifier chip (EEG and EMG) Intan #RHD2216 Custom head fixation apparatus Heim et al.102 https://github.com/leoreh/slutsky_fepsp
Software:Article Title: NMDA receptors regulate the firing rate set point of hippocampal circuits without altering single-cell dynamics.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Cdc42-Forward 5’ TTGTTGGTGATGGTGCTGTTGG N/A Cdc42-Reverse 5’GCTCTCCACCAATCATAACTGTGAC N/A Grin1-Forward 5’ GATGCCCGTAGGAAGCAGATG N/A Grin1-Reverse 5’ GGCTCTGCTCTACCACTCTTTCT N/A Recombinant DNA Plasmid: pcDNA3-HA-eEF2K Kruiswijit et al.96 Addgene plasmid #110160 Plasmid: pAAV-FLEX-tdTomato Boyden lab. Addgene plasmid #28306 Plasmid: pAAV-hDlx-GqDREADD-dTomato-Fishell-4 Dimidschstein et al.97 Addgene plasmid #83897 Software and algorithms Plexon offline-sorter V3 Plexon inc. USA RRID: SCR_000012 Matlab MathWorks RRID: SCR_001622 MiniAnalysis Synaptosoft, Decatur, Georgia, USA RRID: SCR_002184 Graphpad Prism 10.2.2 Graphpad RRID: SCR_002798 ImageJ- Fiji RRID: SCR_002285 AccuSleep – sleep scoring software Barger et al.98 GitHub - zekebarger/AccuSleep: Automatically score rodent sleep using EEG and EMG recordings KlustaKwik – spike sorting software Kadirs et al.99 https://klustakwik.sourceforge.net/ Cell Explorer – cell type characterization Petersen et al.100 https://cellexplorer.org/ Chronux – spectral analysis Bokil et al.101 http://chronux.org/ Custom MATLAB code This paper https://doi.org/10.5281/zenodo.13773883 Other 120MEA200/30iR-Ti Multi Channel Systems MCS-890095 MEA2100-System Multi Channel Systems RRID:SCR_014809 MEA2100-mini-system Multi Channel Systems N/A Micro syringe pump World Precision Instruments UMP3 Pump controller World Precision Instruments MICRO2T Microliter syringe Hamilton Cat# 701RN Syringe needle Hamilton Cat# 7803-03 Cannula tube 23 AWG Component supply Cat# HTX-23T-30 Cannula tube 33 AWG Component supply Cat# HTX-23R Filler rode Component supply Cat# HTX-28R-30 Isoflurane anesthesia vaporizer Kent Scientific SomnoSuite Osmotic pump Alzet Cat# 1007D Vinyl catheter tubing Durect Cat# 007760 Acquisition board for in vivo recordings Open Ephys Cat# OEPS-9030 Amplifier chip (Single units) Intan Cat# RHD2132 Amplifier chip (EEG and EMG) Intan #RHD2216 Custom head fixation apparatus Heim et al.102 https://github.com/leoreh/slutsky_fepsp
In Vivo:Article Title: NMDA receptors regulate the firing rate set point of hippocampal circuits without altering single-cell dynamics.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Cdc42-Forward 5’ TTGTTGGTGATGGTGCTGTTGG N/A Cdc42-Reverse 5’GCTCTCCACCAATCATAACTGTGAC N/A Grin1-Forward 5’ GATGCCCGTAGGAAGCAGATG N/A Grin1-Reverse 5’ GGCTCTGCTCTACCACTCTTTCT N/A Recombinant DNA Plasmid: pcDNA3-HA-eEF2K Kruiswijit et al.96 Addgene plasmid #110160 Plasmid: pAAV-FLEX-tdTomato Boyden lab. Addgene plasmid #28306 Plasmid: pAAV-hDlx-GqDREADD-dTomato-Fishell-4 Dimidschstein et al.97 Addgene plasmid #83897 Software and algorithms Plexon offline-sorter V3 Plexon inc. USA RRID: SCR_000012 Matlab MathWorks RRID: SCR_001622 MiniAnalysis Synaptosoft, Decatur, Georgia, USA RRID: SCR_002184 Graphpad Prism 10.2.2 Graphpad RRID: SCR_002798 ImageJ- Fiji RRID: SCR_002285 AccuSleep – sleep scoring software Barger et al.98 GitHub - zekebarger/AccuSleep: Automatically score rodent sleep using EEG and EMG recordings KlustaKwik – spike sorting software Kadirs et al.99 https://klustakwik.sourceforge.net/ Cell Explorer – cell type characterization Petersen et al.100 https://cellexplorer.org/ Chronux – spectral analysis Bokil et al.101 http://chronux.org/ Custom MATLAB code This paper https://doi.org/10.5281/zenodo.13773883 Other 120MEA200/30iR-Ti Multi Channel Systems MCS-890095 MEA2100-System Multi Channel Systems RRID:SCR_014809 MEA2100-mini-system Multi Channel Systems N/A Micro syringe pump World Precision Instruments UMP3 Pump controller World Precision Instruments MICRO2T Microliter syringe Hamilton Cat# 701RN Syringe needle Hamilton Cat# 7803-03 Cannula tube 23 AWG Component supply Cat# HTX-23T-30 Cannula tube 33 AWG Component supply Cat# HTX-23R Filler rode Component supply Cat# HTX-28R-30 Isoflurane anesthesia vaporizer Kent Scientific SomnoSuite Osmotic pump Alzet Cat# 1007D Vinyl catheter tubing Durect Cat# 007760 Acquisition board for in vivo recordings Open Ephys Cat# OEPS-9030 Amplifier chip (Single units) Intan Cat# RHD2132 Amplifier chip (EEG and EMG) Intan #RHD2216 Custom head fixation apparatus Heim et al.102 https://github.com/leoreh/slutsky_fepsp
|
